Buyclindamycin.ru

Современные методы лечения

Клонирование и секвенирование фракций 2'-F- пиримидинсодержащей РНК-библиотеки

К сожалению, применить метод бело-голубой селекции для полученных колоний оказалось невозможным, поскольку колония-контроль была такого же светло-голубого цвета, как и большинство полученных колоний. Это может быть связано с тем, что длины ДНК фракций I, II и III было недостаточно для того, чтобы сбить рамку считывания β-галактозидазы. Поэтому наличие плазмидной ДНК в колонии клеток E.coli определяли методом ПЦР. Для этого были использованы 5'-праймер seq 1 и 3'-праймер seq 2, комплементарные 3'- и 5'- константным районам вектора pUC18, фланкирующим ПЛУ (рис. 21).

'-константный район ПЛУ pUC18 5'-константный район ПЛУ pUC18

'-AAAGGGTCAGTGCTGCAACATTTTGC-5' 3'- GGACACACTTTAACAATAGGCGA-5'

5'-CCCAGTCACGACGTTGTAAAACG-3' 5'-CCTGTGTGAAATTGTTATCCGCT-3

'-праймер seq 1 3'-праймер seq 2

Рис. 21. Комплексы 5'-праймера seq 1 с 3'-константным районом, фланкирующим ПЛУ вектора pUC18, и 3'-праймера seq 2 с 5'-константным районом, фланкирующим ПЛУ вектора pUC18.

В качестве примера на рис. 22 приведена электрофореграмма реакционных смесей ПЦР для колоний клеток E.coli, трансформированных плазмидной ДНК, содержащей дцДНК фракции I.

Фракция I

pUC18контр. к1 к2 к3 к4 к5

Рис. 22. Электрофоретический анализ реакционных смесей ПЦР для колоний E.coli с плазмидной ДНК фракции I (фракция I, к1, к2, к3, к4, к5 - ПЦР-продукт соответствующих колоний клеток E.coli). В качестве контроля использовали ПЦР-продукт вектора pUC18 (pUC18 контр.). Визуализация полос окрашиванием геля раствором красителя “Stains-All”.

Многокопийную плазмидную ДНК выделяли из индивидуальных колоний клеток E.coli с помощью набора QIAprep Spin Miniprep Kit (QIAGEN) и проверяли наличие дцДНК фракций I, II и III повторно (рис. 23).

Фракция I

к3 к2 к1 pUC18контр.

Рис. 23. Электрофоретический анализ реакционных смесей ПЦР для плазмидных ДНК, содержащих дцДНК фракции I (фракция I, к1, к2, к3 - ПЦР-продукт плазмидных ДНК соответствующих колоний клеток E.coli). В качестве контроля использовали ПЦР-продукт вектора pUC18 (pUC18 контр.). Визуализация полос окрашиванием геля раствором красителя “Stains-All”.

Как видно из электрофореграмм на рис. 22 и рис. 23, полученные ПЦР-продукты обладали меньшей электрофоретической подвижностью, чем контрольный ПЦР-продукт, что связано с наличием вставки ДНК фракции I. Однако практически все ПЦР-продукты обладают разной электрофоретической подвижностью, что может быть связано с потерей части ДНК вставки, встраиванием в вектор pUC18 двух и более молекул ДНК фракций или рекомбинацией двух и более молекул ДНК фракций в составе разных плазмидных ДНК.

Для определения нуклеотидной последовательности ДНК-клонов полученные плазмидные ДНК секвенировали с использованием набора Big Dye Terminators v.3.1 Cycle Sequencing Kit (Applied Biosystems, США) в ЦКП “Секвенирование ДНК” СО РАН. Нуклеотидные последовательности полученных клонов ДНК фракций I, II и III приведены в табл. 6.

Таблица 6. Нуклеотидные последовательности ДНК-клонов фракций I, II и III

Плазмидная ДНК

Нуклеотидная последовательность

Фракция I клон 1

5'-GGATCCTCGCGCGAGTCGTCTGCACGGTAGCGAGGTGCTCTCATTGGGAAGTTTG GGTTGAGACCGCATCGTCCTCCC- 3'

Фракция I клон 2

5'-GGATCCTCGCGCGAGTCGTCTGCCCAGGCTACACGCATGTTGATTCTGATGATCG CGCGAGTCGTCTGGCCACGGAGTTTAGGTTCCATGTTTCCGCTGTATGACGATCCGCATCGTCCTCCC- 3'

Фракция I клон 3

5'-GGATCCTCGCGCGAGTCGTCTGGGCAGCACCCGAACGAGAGCGCGAGACTGAGG ATTGCCCTCCGCATCGTCCTCCC- 3'

Фракция I клон 4

5'-GGATCCTCGCGCGAGTCGTCTGGCGGCAGGATCAGGAATTGATTAGAAGTTCTTA CTCCGTTCCGCATCGTCCTCCCTATAGTGAGTCGTATTAATTTCAGTCCTCACCGCATCGTCCGCATCGTCCTCCC- 3'

Фракция II клон 1

5'-GGATCCTCGCGCGAGTCGTCTGGCACGGGCAGGGGATACGAGTGACGTTGGCGT CAACACTACCGCATCGTCCTCCC- 3'

Фракция II клон 2

5'-GGATCCTCGCGCGAGTCGTCTGCAGGGGAGAGGATAATGTTCAGCTAGACCGGG CTTCAATCCCGCATCGTCCTCCC- 3'

Фракция II клон 3

5'-GGATCCTCGCGCGAGTCGTCTGCACACACAGGCAACAAACTGTGTCGCGCGAGT CGTCTGTGGGTAAACGAGGGTGGGGCAGAGATGTACTCAGAAAACACCGCATCGTCCTCCC- 3'

Фракция II клон 4

5'-GGATCCTCGCGCGAGTCGTCTGGCGACACGTGGCATGACGAGGTTAATCGCGCG AGTCGTCTGCACGATAGTGGTGAGGCCGGGGCATGTGTGGGTATGCTTAACCGCATCGTCCTCCC - 3'

Фракция II клон 5

5'-GGATCCTCGCGCGAGTCGTCTGCACACACAGGCAACAAACTGTGTCGCGCGAGT CGTCTGCAGGGTGAACAAGGGTGGGGCAGAGATGTACTCAGAAAACACCGCATCGTCCTCCC- 3'

Фракция III клон 1

5'-GGATCCTCGCGCGAGTCGTCTGGCACGATCGCAGCATTTGGCAACACTGGTCGC GCGAGTCGTCTGGGCATAATGAGCCACAGGTTGGAAGTATTGCTTCACTTGGCCGCATCGTCCTCCC- 3'

Фракция III клон 2

5'- GGATCCTCGCGCGAGTCGTCTGGGGAGGGCGAGTCGTCTGGCTCGAGCTAGGCT GTGCATTCGCAACCACTCACATCGAACCGCATCGTCCTCCC- 3'

Фракция III клон 3

5'- GGATCCTCGCGCGAGTCGTCTGGGCACGCGGAAAGACGACGAGCCGTGGCATCG TAGCTCAACCGCATCGTCCTCCC- 3'

Фракция III клон 4

5'-GGATCCTCGCGCGAGTCGTCTGGGGATGAGCGTTGTTACACGCATCATCGCGCG AGTCGTCTGGGGAGGGGAGTAGCTTTTCCGATGGAGACTGAATGCTCCACCGCATCGTCCTCCC- 3'

Фракция III клон 5

5'-GGATCCTCGCGCGAGTCGTCTGCACACACAGGCAACACCATGTGTCGCGCGAGT CGTCTGGCGGGGGCCGCGGCAGGCATGAACGATGCAACTCATCAGACCGCATCGTCCTCCC- 3'

Фракция III клон 6

5'-GGATCCTCGCGCGAGTCGTCTGCGGGTAAACAAGGGTGGGGCAGAGATGTACT CAGAAAACACCGCATCGTCCTCCC- 3'

Перейти на страницу: 1 2 3